/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 26 The DNA polymerases are position... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

The DNA polymerases are positioned over the following DNA segment (which is part of a much larger molecule) and moving from right to left. If we assume that an Okazaki fragment is made from this segment, what will be the fragment's sequence? Label its \(5^{\prime}\) and \(3^{\prime}\) ends. $$5^{\prime} \ldots . CCTTAAGACTAACTACTTACTGGGATC....3'$$ $$3^{\prime} \ldots . GGAATTCTGATTGATGAATGACCCTAG....5$$

Short Answer

Expert verified
Okazaki fragment sequence: 5' CCTTAAGACTAACTACTTACTGGGATC 3'.

Step by step solution

01

Identify the Template Strand

Determine which strand acts as the template for the new DNA synthesis. Since the DNA polymerases are moving from right to left and we are focusing on Okazaki fragments, the lower strand (3′ to 5′ direction) will be used as the template for synthesizing an Okazaki fragment.
02

Determine the Direction of Synthesis

Okazaki fragments are synthesized in a direction opposite to that of the movement of DNA polymerases. Since the template is moving from 3′ to 5′, the Okazaki fragment will grow from 5′ to 3′ direction.
03

Complementary Base Pairing

Using the template strand $$3^{ alkdot}{5'} GGAATTCTGATTGATGAATGACCCTAG .... 5'$$, determine the sequence of the new fragment by complementary base pairing: G will pair with C, A with T, T with A, etc. The result is CCTTAAGACTAACTACTTACTGGGATC.
04

Determine the Ends of the Fragment

The synthesis begins at the rightmost end and proceeds leftwards. Thus, the 5′ end of the new fragment is on the right and the 3′ end is on the left. Therefore, the fragment reads: 5' CCTTAAGACTAACTACTTACTGGGATC 3'.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

DNA polymerase
DNA polymerase is an essential enzyme found in all living cells. It plays a crucial role in DNA replication and repair. Think of DNA polymerase as the workhorse responsible for copying the DNA’s code, letter by letter, to create a new strand of DNA. This is achieved by moving along the template strand, synthesizing a complementary strand as it progresses.

There are several types of DNA polymerases, each with a specific function. These enzymes are crucial for the accuracy of DNA replication, ensuring that genetic information is protected during cell division. As the DNA polymerase synthesizes new DNA, it can also correct mistakes due to its proofreading ability. This guarantees high fidelity in DNA replication.

In the context of Okazaki fragments, which are short sequences of nucleotides synthesized on the lagging strand during DNA replication, DNA polymerase adds nucleotides in a 5' to 3' direction. However, since the DNA unwinds in a 3' to 5' direction, replication occurs discontinuously, thus requiring the formation of Okazaki fragments.
Template strand
The template strand is one of the two strands of the DNA double helix. It's used as a guiding sequence for synthesizing a complementary strand. During DNA replication, enzymes like DNA polymerase read this template strand and add complementary nucleotides to form a new Okazaki fragment.

It’s important to distinguish between the leading and the lagging strands in the replication process. The leading strand is synthesized continuously, whereas the template strand for Okazaki fragments is synthesized in short bursts. This occurs because the DNA polymerase can only add nucleotides in the 5' to 3' direction.

In our exercise, the template strand is written as 3' to 5', meaning the new complementary sequence will be synthesized using this strand, resulting in short segments that combine to complete the DNA strand. Understanding the role of the template strand is vital for grasping how the natural error-correcting features of DNA polymerase are engaged during replication.
Complementary base pairing
Complementary base pairing is the principle through which DNA strands align themselves with perfect matches of nucleotides. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). This consistent pairing is foundational for the accurate replication of DNA.

When a new DNA strand is synthesized, each base on the template strand is matched with its complement, ensuring the fidelity of the genetic information. As a result, if the template strand reads 3'-...GGAATT...-5', then the new strand will be complementary and read 5'-...CCTTAA...-3'.

This precise mechanism allows cells to replicate their genome accurately and ensures that new cells have an exact copy of the DNA. Complementary base pairing isn’t only essential for replication; it also plays a critical role in processes like transcription and DNA repair.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.