/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 26 A geneticist is interested in de... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A geneticist is interested in determining the locations of methylated cytosines within a fragment of DNA. She treats some copies of the fragment with sodium bisulfite and leaves some copies untreated. She then sequences the treated and untreated copies of the fragment and obtains the following results. Give the original sequence of the DNA fragment, and indicate the locations of methylated cytosines. Sequence without - AATTGCCCGATCGATTAAGCCA- treatment: Sequence with - AATTGTTTGATCGATTAAGCTA- treatment:

Short Answer

Expert verified
The original sequence is AATTGCCCGATCGATTAAGCCA with methylation at the 7th position (counting from 1).

Step by step solution

01

Understand Sodium Bisulfite Treatment

Sodium bisulfite treatment deaminates unmethylated cytosines, converting them to uracils (which appear as thymines after PCR amplification) in treated samples. Methylated cytosines remain unchanged.
02

Compare Untreated and Treated Sequences

Align the untreated sequence (original copy without treatment) AATTGCCCGATCGATTAAGCCA with the treated sequence AATTGTTTGATCGATTAAGCTA. Compare each corresponding cytosine to determine which cytosines morph into thymines.
03

Identify Unchanged and Changed Cytosines

In positions where 'C' in the untreated becomes 'T' in the treated sequence, the cytosine was unmethylated. If the 'C' remains a 'C', it indicates a methylated cytosine. Thus: the 3rd, 4th, 5th, 11th, and 19th cytosines in the untreated sequence become 'T' due to un-methylation.
04

Original Sequence Confirmation

Verify that the modified sequence aligns with the concept of bisulfite conversion. The original sequence, before any conversions, is AATTGCCCGATCGATTAAGCCA, and methylated cytosines are those that remain unchanged in the treated sequence.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Sodium Bisulfite Treatment
Sodium bisulfite treatment is a special chemical method used to analyze DNA methylation, particularly for identifying which cytosines in DNA are methylated. When DNA is treated with sodium bisulfite, unmethylated cytosines are converted to uracils. After the polymerase chain reaction (PCR), these uracils are detected as thymines in DNA sequencing. This process is essential because it allows researchers to differentiate between methylated and unmethylated cytosines by observing changes in the DNA sequence. The process can be summarized as follows:

  • Sodium bisulfite transforms unmethylated cytosines into uracils.
  • Uracils are read as thymines after PCR.
  • Methylated cytosines remain unaffected by this process.
By using sodium bisulfite treatment, researchers can gain insight into DNA methylation patterns, which play a crucial role in gene expression and epigenetic regulation.
Genetic Sequencing
Genetic sequencing is the process of determining the exact sequence of nucleotides within a DNA molecule. It is like reading the language of life, made up of the letters A, T, C, and G, which stand for adenine, thymine, cytosine, and guanine. In the context of DNA methylation, sequencing allows scientists to understand changes in DNA after sodium bisulfite treatment.

The sequence of untreated DNA acts as a reference or 'original copy,' showing all cytosines in their initial state. After sodium bisulfite treatment, the treated sequence shows changes where cytosines have turned into thymines. By comparing these sequences, researchers can pinpoint where methylated cytosines are located:

  • The untreated sequence shows all the original Cytosines.
  • The treated sequence reveals which cytosines were unmethylated and converted to thymines.
  • Researchers use this comparison to map methylated regions.
This method is incredibly powerful for identifying epigenetic modifications that affect gene expression without altering the underlying DNA sequence.
Methylated Cytosines
Methylated cytosines are cytosine bases in the DNA that have a methyl group added to them. This chemical modification usually occurs in a process called DNA methylation and is a key epigenetic mechanism. Methylated cytosines are important because they influence gene expression, often preventing genes from being turned on.

During the sodium bisulfite treatment and subsequent genetic sequencing, methylated cytosines remain unchanged, unlike their unmethylated counterparts. By comparing DNA sequences before and after treatment, researchers can identify which cytosines are methylated:

  • Methylated cytosines remain 'C' in both treated and untreated sequences.
  • Unmethylated cytosines show as 'C' in untreated but become 'T' after treated.
  • This distinction allows researchers to map DNA methylation patterns efficiently.
Understanding where methylated cytosines are located in the genome helps in studying gene regulation and various biological processes such as development and disease progression.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

In recent years, techniques have been developed to clone mammals through a process called nuclear transfer, in which the nucleus of a somatic cell is transferred to an egg cell from which the nuclear material has been removed (see Chapter 22). Research has demonstrated that when a nucleus from a differentiated somatic cell is transferred to an egg cell, only a small percentage of the resulting embryos complete development, and many of those that do die shortly after birth. In contrast, when a nucleus from an undifferentiated embryonic stem cell is transferred to an egg cell, the percentage of embryos that complete development is significantly higher (W. M. Rideout, K. Eggan, and R. Jaenisch. 2001. Science \(293: 1095-1098\) ). Propose a possible reason for why a higher percentage of cloned embryos develop successfully when the nucleus transferred comes from an undifferentiated embryonic stem cell.

Briefly explain how patterns of DNA methylation are transmitted across cell divisions.

What three molecular mechanisms alter chromatin structure and are responsible for many epigenetic phenotypes?

Much of DNA methylation in eukaryotes occurs at CpG dinucleotides, but some individual cytosine nucleotides are also methylated to form 5-methylcytosine. Considering what you know about the process by which DNA methylation at CpG dinucleotides is maintained across cell division, do you think that methylation at individual C nucleotides would also be maintained by the same process? Explain your reasoning.

A DNA fragment with the following base sequence has some cytosine bases that are methylated (indicated by \(\mathrm{C}^{*}\) ) and others that are unmethylated. To determine the locations of methylated and unmethylated cytosines, researchers sequenced this fragment both with and without treatment with sodium bisulfite. Give the sequence of bases that will be read with and without bisulfite treatment. \- ATCGC*GTTAC*GTTGC*GTCA-

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.