/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 10 What are the two basic types of ... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

What are the two basic types of terminators found in bacterial cells? Describe the structure of each type.

Short Answer

Expert verified
The two basic terminators in bacteria are Rho-independent and Rho-dependent. Rho-independent terminators form a hairpin in the RNA, while Rho-dependent require the Rho protein.

Step by step solution

01

Introduction to Terminators

In bacterial cells, terminators are specific sequences of nucleotides that signal the end of transcription. Understanding these terminators is crucial for grasping how genetic information is accurately transferred from DNA to RNA.
02

Identifying the Two Basic Types

The two basic types of terminators in bacterial cells are 'Rho-dependent terminators' and 'Rho-independent terminators' (also known as intrinsic terminators). Each type has distinct structural characteristics and mechanisms of action.
03

Structure of Rho-independent Terminators

Rho-independent terminators are characterized by a GC-rich region of the DNA sequence followed by a series of adenines (A's). This GC-rich region forms a hairpin loop structure in the RNA transcript, which causes the RNA polymerase to pause and subsequently dissociate from the DNA.
04

Structure of Rho-dependent Terminators

Rho-dependent terminators require a protein called Rho factor to terminate transcription. The Rho protein binds to a specific site on the RNA transcript, called the 'Rho utilization site,' and moves along the RNA until it reaches the RNA polymerase, causing transcription to terminate when it catches up.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Rho-dependent terminators
In bacterial transcription, Rho-dependent terminators play a critical role by relying on a specific protein known as the Rho factor to end the transcription of RNA. Unlike other terminators, they do not have a distinct sequence that signals the end directly. Instead, they require the interaction with this protein.

Here's how it works:
  • The Rho protein binds to a specific sequence on the newly formed RNA called the Rho utilization (rut) site.
  • Once bound, Rho utilizes its helicase activity to travel along the RNA molecule towards the RNA polymerase.
  • Upon reaching the polymerase, it disrupts the RNA-DNA hybrid within it, leading to the release of the RNA transcript and termination of transcription.
This mechanistic process ensures that the Rho-dependent terminators effectively bring about the cessation of RNA synthesis by using the coordinated action of the RNA molecule with the Rho protein.
Rho-independent terminators
Rho-independent terminators, also known as intrinsic terminators, operate without the need for additional proteins like the Rho factor. They are solely reliant on the sequence of nucleotides within the DNA and the resulting RNA they produce.

Key features include:
  • A GC-rich sequence within the DNA that creates a complementary structure in the RNA.
  • This sequence folds back to form a stem-loop structure or hairpin in the RNA transcript.
  • Following this hairpin is a series of uracils (U's) in the RNA, corresponding to adenines (A's) in the DNA.
  • The formation of the hairpin causes the RNA polymerase to pause, while the instability of the uracil-rich sequence leads the RNA to detach from the DNA, finalizing the termination.
This type of termination is efficient because it depends entirely on the chemical properties and structure of nucleic acids, without requiring additional cellular machinery.
Transcription termination
Transcription termination is a vital step in gene expression, marking the conclusion of the RNA synthesis process. In bacteria, this step is often facilitated by well-defined terminator sequences that ensure the proper release of the newly synthesized RNA.

There are mainly two types of mechanisms involved:
  • Rho-dependent termination: Relies on the Rho factor, a protein that moves along the RNA transcript to halt transcription.
  • Rho-independent termination: Utilizes the natural formation of hairpin structures in RNA, followed by a string of uracils, to prompt RNA polymerase detachment.
The completion of transcription ensures that RNA is accurately transcribed from DNA, which is essential for subsequent steps in gene expression, such as translation into proteins.
RNA polymerase
RNA polymerase is the enzyme responsible for transcribing DNA into RNA. During bacterial transcription, it plays a central role in synthesizing RNA by covalently linking nucleotides to form an RNA strand complementary to the DNA template.

The enzyme's function extends through:
  • Initiation: Binding to a promoter region on DNA and unwinding the DNA strands to begin RNA synthesis.
  • Elongation: Continuously adding RNA nucleotides complementary to the DNA strand.
  • Termination: Being halted either through the action of Rho proteins or the formation of hairpin loops in the RNA, indicating the end of transcription.
RNA polymerase's ability to transcribe RNA accurately is crucial for gene expression and ultimately affects how genetic information is passed on within the cell.
Rho factor protein
The Rho factor protein is an essential component in bacterial transcription termination, specifically in Rho-dependent pathways. As a transcription termination factor, it ensures the proper and timely end of the RNA synthesis process.

Key attributes of the Rho factor include:
  • It is a helicase enzyme, meaning it unwinds RNA from the DNA template.
  • Rho factor binds to the RNA at the rut site, an essential part of the RNA sequence during transcription.
  • Once attached, it utilizes ATP (energy currency of the cell) to move along the RNA to catch up with the RNA polymerase, subsequently leading to termination.
Without the action of the Rho factor, certain bacterial genes might not terminate effectively, disrupting the regulation of gene expression. This protein exemplifies how bacteria have evolved specialized mechanisms to fine-tune their cellular processes.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

The following sequence of nucleotides is found in a single-stranded DNA template: $$ATTGCCAGATCATCCCAATAGAT$$ Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is \(5^{\prime}\) and which end is \(3^{\prime} ?\) b. Give the sequence and identify the \(5^{\prime}\) and \(3^{\prime}\) ends of the RNA transcribed from this template.

What parts of DNA make up a transcription unit? Draw a typical bacterial transcription unit and identify its parts.

Enhancers are sequences that affect the initiation of the transcription of genes that are hundreds or thousands of nucleotides away. Transcriptional activator proteins that bind to enhancers usually interact directly with transcription factors at promoters by causing the intervening DNA to loop out. An enhancer of bacteriophage T4 does not function by looping of the DNA (D. R. Herendeen et al. 1992. Science 256: 1298-1303). Propose some mechanisms other than DNA looping by Which this enhancer might affect transcription at a gene thousands of nucleotides away.

The following diagram represents a transcription unit in a hypothetical DNA molecule. $$\begin{array}{l} \text { 5' } \ldots \text { TTGACA } \ldots \text { TATAAT } \ldots 3^{\prime} \\\ \text { 3' } \ldots \text { AACTGT } \ldots \text { ATATTA } \ldots 5^{\prime} \end{array}$$ a. On the basis of the information given, is this DNA from a bacterium or from a eukaryotic organism? b. If this DNA molecule is transcribed, which strand will be the template strand and which will be the nontemplate strand? c. Where, approximately, will the transcription start site be?

A strain of bacteria possesses a temperature-sensitive mutation in the gene that encodes the rho subunit. At high temperatures, rho is not functional. When these bacteria are raised at elevated temperatures, which of the following effects would you expect to see? Explain your reasoning for accepting or rejecting each of these five options. a. Transcription does not take place. b. All RNA molecules are shorter than normal. c. All RNA molecules are longer than normal. d. Some RNA molecules are longer than normal. e. RNA is copied from both DNA strands.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.