/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 28 A linear piece of DNA was broken... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced. The sequence of each fragment is shown below. Fragment 1: \(5^{\prime}-\) TAGITAAAAC- 3 Fragment \(2: \quad\) 5'-ACCGCAATACCCTAGITAAA-3' Fragment 3: \(5^{\prime}-\) CCCTAGTTAAAAC-3' Fragment \(4: \quad 5^{\prime}-A C C G C A A T A C C C T A G I T-3^{\prime}\) Fragment \(5: \quad 5^{\prime}-A C C G C A A T A C C C T A G T T A A A-3^{\prime}\) Fragment \(6: \quad 5^{\prime}-\) ATTTACCGCAAT-3 On the basis of overlap in sequence, create a cont ig sequence of the original fragment.

Short Answer

Expert verified
The sequence of the original DNA fragment is "ATTTACCGCAATACCCTAGTTAAAAC."

Step by step solution

01

Identify the Overlapping Sequences

We start by comparing the sequences to find overlaps. Fragment 1 ends with "TAGITAAAAC". Checking the other fragments, Fragment 2 begins with "TAGITAAA." This indicates an overlap of "TAGITAAA," linking Fragment 1 and Fragment 2.
02

Establish Continuous Sequence from Overlaps

Continue finding overlaps: Fragment 2 ends with "TAAA" and Fragment 3 starts with "CCCTAGTTAAAAC," overlapping with "TAAAAC." Now we know Fragment 2 should extend to connect Fragment 3. Fragment 4 starts with "ACCGCAATA," which is a segment found in Fragment 6, and also overlaps at the end of Fragment 3. Finally, Fragment 5 encompasses an extended version of this sequence, integrating all previous matches.
03

Assemble Full DNA Sequence

By combining these fragments based on identified overlaps, we begin with Fragment 6: "ATTTACCGCAAT," continuing with Fragment 4, which shares "ACCGCAAT", connects to Fragment 5, aligning "TAGTTA," and progresses to Fragment 2 with "TAGITAAA." This links Fragment 1 and then closes with Fragment 3 through the overlap identified with "TAAAC." Thus, the complete original sequence is "ATTTACCGCAATACCCTAGTTAAAAC."

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Genetic Overlap Analysis
Genetic overlap analysis is the first critical step in reassembling DNA sequences from fragment data. Imagine trying to put together a puzzle without knowing the picture beforehand. Luckily, with DNA sequencing, each fragment provides clues at its edges about where it fits relative to others. By examining the sequence ends of these fragments, scientists look for stretches of identical sequences - known as overlaps - that provide hints about how to join the fragments into a coherent longer sequence.

To perform this analysis, you systematically compare each fragment's end sequences with the beginning sequences of other fragments. If they match, it suggests that these fragments are neighbors in the original DNA sequence. For instance, identifying that one fragment ends with the string "TAGITAAA" and another begins with the same string allows us to confidently link them together, knowing they overlap and are sequentially adjacent.

In practice, this step requires meticulous comparison and pattern recognition, often aided by computational tools due to the complexity and volume of data in real-world sequencing tasks.
Fragment Assembly
Fragment assembly is the process following genetic overlap analysis where these overlapping DNA sequences are joined to reconstruct the original sequence. This involves integrating individual DNA pieces that were split into fragments during sequencing.

The goal here is to maintain the correct sequence of nucleotides as they existed in the original DNA strand. This process can be thought of like reconstructing a book from shredded pages where one has to carefully align consecutive pieces to ensure the story flows without errors. The identified overlaps from the previous step guide this alignment.

With advancements in technology, sophisticated algorithms now assist in automating this task, ensuring all overlaps are accurately identified and aligned without human error. The successful assembly of fragments results in a seamless bigger picture, offering insights into genetic structures and functions.
Contig Sequence Construction
Once the fragments are properly assembled, the contig sequence construction starts. A contig is a continuous, uninterrupted sequence of DNA assembled from overlapping fragments. This contig acts as the reconstructed version of the original DNA molecule, effectively representing the entire segment as one cohesive sequence.

Creating a contig is like completing a jigsaw puzzle, where each piece corresponds to a fragment placed through precise overlap analysis. In our example, the complete sequence is derived from carefully connecting fragments based on their overlaps until an entire, seamless DNA sequence is produced. Starting with a piece verifying overlaps, we verified each match until the sequence "ATTTACCGCAATACCCTAGTTAAAAC" was formed.

The importance of constructing contigs lies in its application in genomic research, where accurately determining these sequences leads to a better understanding of genetic codes and functions. This step consolidates the previous analyses and assemblies into a robust and finely detailed picture that represents the integrity of genetic information.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

How does proteomics differ from genomics?

James Noonan and his colleagues ( \(2005,\) Science \(309.597-599)\) set out to study genome sequences of an extinct species of cave bear. They extracted DNA from 40,000 -year-old bones from a cave bear and used a metagenomic approach to isolate, identify, and sequence the cave-bear DNA. Why did they use a metagenomic approach when their objective was to sequence the genome of one species (the cave bear)?

(a) What is genomics and how does structural genomics differ from functional genomics? (b) What is comparative genomics?

How does the density of genes found on chromosome 22 compare with the density of genes found on chromosome 21 , two similar- sized chromosomes? How does the number of genes on chromosome 22 compare with the number found on the Y chromosome? To answer these questions, go to wwwensembl. org. Under the heading Species, sciect Hienan. On the left-hand side of the next page click on Karyotype. Pictures of the human chromosomes will appear. Click on dromosome 22 and sclect Chromosome Summary. You will be shown a picture of this chromosome and a histogram illustrating the densities of total genes (uncdored bars) and of known genes (cdored bars). The total numbers of genes, along with the chromosome Length in base pain are given at the bottom of the diagram. Write down the total length of the chromosome and the number of protein-coding genes. Now go to chromosome 21 by sclecting it from the Change Chromosome drop-down. Examine the total length and total number of protein-coding genes for dimmosome \(21 .\) Now do the same for the \(Y\) chromosome. Calculate the gene density (number of genes/length) for chromosomes \(22,21,\) and \(Y\) a. Which chomosome has the highest density and greatest number of genes? Which has the fewest? b. Examine in more detail the genes at the tip of the short arm of the Y chromosome by clicking on the top bar in the histogram of genes. Jump to local ion view. A more detailed view will be shown. What lanown genes are found in this region? How many protein-coding genes are there in this region?

What is a microarray? How can it be used to obtain information about gene function?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.