/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 15 Explain how the spliceosome reco... [FREE SOLUTION] | 91影视

91影视

Log out

Learning Materials

Features

Discover

Chapter 21: Problem 15

Explain how the spliceosome recognizes introns.

Short Answer

Expert verified
Answer: The key steps in the splicing process include: 1) Recognition of pre-mRNA structure, such as splice sites and branch point, 2) Small Nuclear Ribonucleoproteins (snRNPs) recognition and binding to the splice sites, 3) Formation of the spliceosome complex, 4) Activation of the spliceosome through conformational changes and rearrangements, and 5) Intron removal through consecutive transesterification reactions followed by exon joining. This process results in a spliced mRNA ready for translation.

Step by step solution

01

Pre-mRNA Structure

Pre-mRNA molecules contain the coding regions (exons) and the non-coding regions (introns) that need to be removed during the splicing process. The introns have specific sequences at their ends, known as the 5' splice site, the 3' splice site, and the branch point. The consensus sequences for these sites are GU for the 5' splice site, AG for the 3' splice site, and a conserved adenine nucleotide at the branch point. The spliceosome recognizes these specific sequences to identify the introns.
02

Small Nuclear Ribonucleoproteins (snRNPs) Recognition

The spliceosome consists of small nuclear ribonucleoproteins (snRNPs) that recognize and bind to the specific splice sites. The major snRNPs involved in this process are U1, U2, U4, U5, and U6. Each snRNP is a complex of a small nuclear RNA (snRNA) and a protein. For example, U1 snRNA base pairs with the 5' splice site, and U2 snRNA base pairs with the branch point.
03

Formation of the Spliceosome

Once the snRNPs recognize the specific splice site sequences, they assemble on the pre-mRNA molecule. The U1 snRNP binds to the 5' splice site, and the U2 snRNP binds to the branch point, forming an early spliceosome complex called the A complex. U4, U5, and U6 snRNPs then join to form a fully assembled spliceosome known as the B complex.
04

Spliceosome Activation

To become catalytically active, the spliceosome undergoes a series of conformational changes and rearrangements. The U1 and U4 snRNPs are released, and the U6 snRNA interacts with the 5' splice site and the U2 snRNA at the branch point. This rearrangement brings the 5' and 3' splice sites and the branch point close to each other, facilitating the intron removal.
05

Intron Removal

The activated spliceosome then carries out two consecutive transesterification reactions. In the first reaction, the 2'-OH group of the conserved adenine at the branch point attacks the 5' splice site, resulting in the cleavage of the 5' exon-intron boundary and the formation of a lariat intron structure. In the second reaction, the 3'-OH group of the released 5' exon attacks the 3' splice site, releasing the lariat intron and joining the two exons together. The spliced mRNA, now devoid of introns and with connected exons, is ready for translation. Meanwhile, the spliceosome disassembles, and the snRNPs are recycled for further splicing events.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91影视!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

How does the mechanism of group I introns differ from that of group II introns? Which is more similar to the spliceosome-catalyzed reaction?

Explain why decapping and deadenylation are common mechanisms involved in RNA decay.

Why is the phosphorylation state of the RNA polymerase II CTD an important component of transcription? Describe the changes that the CTD undergoes from initiation to termination.

What three forms of RNA are found in both prokaryotes and eukaryotes? Why are these three common to all organisms?

The DNA sequence of a gene follows. If this is the sense strand, write the sequence of the mRNA transcript formed. CGCGGATCCTTGAATTCTAAATAAACCATTT ACCACCATGACC
See all solutions

Recommended explanations on Biology Textbooks

Biological Molecules

Read Explanation

Biology Experiments

Read Explanation

Communicable Diseases

Read Explanation

Cell Cycle

Read Explanation

Heredity

Read Explanation

Biological Structures

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.